Eaton & Ree (2013) single-end RAD data set

Here we demonstrate a denovo assembly for an empirical RAD data set to give a general idea of the results you might expect to recover. This example was run on a 20-core workstation with 64GB RAM, and takes about 20 minutes to run completely.

We will use the 13 taxa Pedicularis data set from Eaton and Ree (2013) (open access link). This data set is composed of single-end 75bp reads from a RAD-seq library prepared with the PstI enzyme. This data set also serves as an example for several of our analysis cookbooks that demonstrate methods for analyzing RAD-seq results. So after you finish this assembly head over there to check out fun ways to analyze the data.

Download the data set (Pedicularis)

These data are archived on the NCBI sequence read archive (SRA) under accession id SRP021469. For convenience, the data are also hosted at a public Dropbox link which is a bit easier to access. Run the code below to download and decompress the fastq data files, which will save them into a directory called example_empirical_data/. The compressed file size is approximately 1.1GB.

## curl grabs the data from a public dropbox url
## the curl command uses an upper-case o argument, not a zero.
>>> curl -LkO https://dl.dropboxusercontent.com/u/2538935/example_empirical_rad.tar.gz

## the tar command decompresses the data directory
>>> tar -xvzf example_empirical_rad.tar.gz

Setup a params file

Always start by using the -n {name} argument to create a new named Assembly. I’ll use the name base to indicate this is the base assembly from which we will later create several branches.

>>> ipyrad -n pedicularis

This will print the message:

New file 'params-pedicularis.txt' created in /home/deren/Documents/ipyrad/tests

In this case, the data come to us already demultiplexed so we are going to simply set the sorted_fastq_path to tell ipyrad the location of our data files. You can select multiple files at once using regular expressions, in this example we use an asterisk (*.gz) to select all files in the directory ending in .gz. We also set a project_dir, which is useful for grouping all our results into a single directory. For this we’ll use name the project directory “analysis-ipyrad”. If this folder doesn’t exist then ipyrad will create it. Take note when entering the values below into your params file that they properly correspond to parameters 1 and 4, respectively.

## Use your text editor to enter the following values:
## The wildcard (*) tells ipyrad to select all files ending in .gz
analysis-ipyrad                   ## [1] [project_dir] ...
example_empirical_rad/*.gz        ## [4] [sorted_fastq_path] ...

We’ll add a few additional options as well to: filter for adapters (param 16); trim the 3’ edge of R1 aligned loci by 5bp (param 26; this is optional, but helps to remove poorly aligned 3’ edges); and produce all output formats (param 27).

## enter the following params as well
2                                ## [16] [filter_adapters] ...
0, 5, 0, 0                       ## [26] [trim_loci] ...
*                                ## [27] [output_formats] ...

We’ll leave the remaining parameters at their default values.

Step 1: Load the fastq data

Start an ipyrad assembly by running step 1. When the data location is entered as a sorted_fastq_path (param 4), as opposed to the raw_fastq_path (param 2), step 1 simply counts the number of reads for each Sample and parses the file names to extract names for each Sample. For example, the file 29154_superba.fastq.gz will be assigned to Sample 29154_superba. We use the -s argument followed by 1 to tell ipyrad to run step 1. We also pass it the -r argument so that it will print a results summary when finished.

>>> ipyrad -p params-base.txt -s 1 -r
 -------------------------------------------------------------
  ipyrad [v.0.5.15]
  Interactive assembly and analysis of RAD-seq data
 -------------------------------------------------------------
  New Assembly: pedicularis
  host compute node: [20 cores] on tinus

  Step 1: Loading sorted fastq data to Samples
  [####################] 100%  loading reads         | 0:00:11
  13 fastq files loaded to 13 Samples.


Summary stats of Assembly pedicularis
------------------------------------------------
                        state  reads_raw
29154_superba               1     696994
30556_thamno                1    1452316
30686_cyathophylla          1    1253109
32082_przewalskii           1     964244
33413_thamno                1     636625
33588_przewalskii           1    1002923
35236_rex                   1    1803858
35855_rex                   1    1409843
38362_rex                   1    1391175
39618_rex                   1     822263
40578_rex                   1    1707942
41478_cyathophylloides      1    2199740
41954_cyathophylloides      1    2199613

Run the remaining assembly steps

Because the point of this tutorial is to demonstrate run times and statistics, I will leave the rest of the parameters at their defaults and simply run all remaining steps. Further below I will explain in more detail the stats files for each step and what the values mean. To fully assemble this data set on a 4-core laptop takes about 2.25 hours. The example here was run on a 20-core workstation and can finish in ~20 minutes.

## run steps 2-7
>>> ipyrad -p params-base.txt -s 234567
 -------------------------------------------------------------
  ipyrad [v.0.5.15]
  Interactive assembly and analysis of RAD-seq data
 -------------------------------------------------------------
  loading Assembly: pedicularis
  from saved path: ~/Documents/ipyrad/tests/analysis-ipyrad/pedicularis.json
  host compute node: [20 cores] on tinus

  Step 2: Filtering reads
  [####################] 100%  processing reads      | 0:01:21

  Step 3: Clustering/Mapping reads
  [####################] 100%  dereplicating         | 0:00:09
  [####################] 100%  clustering            | 0:05:02
  [####################] 100%  building clusters     | 0:00:30
  [####################] 100%  chunking              | 0:00:05
  [####################] 100%  aligning              | 0:03:27
  [####################] 100%  concatenating         | 0:00:17

  Step 4: Joint estimation of error rate and heterozygosity
  [####################] 100%  inferring [H, E]      | 0:01:17

  Step 5: Consensus base calling
  Mean error  [0.00283 sd=0.00081]
  Mean hetero [0.01563 sd=0.00238]
  [####################] 100%  calculating depths    | 0:00:05
  [####################] 100%  chunking clusters     | 0:00:07
  [####################] 100%  consens calling       | 0:03:12

  Step 6: Clustering at 0.85 similarity across 13 samples
  [####################] 100%  concat/shuffle input  | 0:00:06
  [####################] 100%  clustering across     | 0:03:16
  [####################] 100%  building clusters     | 0:00:06
  [####################] 100%  aligning clusters     | 0:01:14
  [####################] 100%  database indels       | 0:00:15
  [####################] 100%  indexing clusters     | 0:00:09
  [####################] 100%  building database     | 0:00:30

  Step 7: Filter and write output files for 13 Samples
  [####################] 100%  filtering loci        | 0:00:06
  [####################] 100%  building loci/stats   | 0:00:01
  [####################] 100%  building vcf file     | 0:00:08
  [####################] 100%  writing vcf file      | 0:00:00
  [####################] 100%  building arrays       | 0:00:04
  [####################] 100%  writing outfiles      | 0:01:48
  Outfiles written to: ~/Documents/ipyrad/tests/analysis-ipyrad/pedicularis_outfiles


Summary stats of Assembly pedicularis
------------------------------------------------
                        state  reads_raw  reads_passed_filter  clusters_total
29154_superba               6     696994               689996          130735
30556_thamno                6    1452316              1440314          199587
30686_cyathophylla          6    1253109              1206947          233183
32082_przewalskii           6     964244               955480          146566
33413_thamno                6     636625               626084          169514
33588_przewalskii           6    1002923               993873          153089
35236_rex                   6    1803858              1787366          410136
35855_rex                   6    1409843              1397068          169357
38362_rex                   6    1391175              1379626          128389
39618_rex                   6     822263               813990          142844
40578_rex                   6    1707942              1695523          215721
41478_cyathophylloides      6    2199740              2185364          166229
41954_cyathophylloides      6    2199613              2176210          293120

                        clusters_hidepth  hetero_est  error_est  reads_consens
29154_superba                      34539    0.015084   0.002612          32913
30556_thamno                       51736    0.016421   0.003716          48957
30686_cyathophylla                 53357    0.014842   0.003001          50649
32082_przewalskii                  41518    0.018446   0.002874          39315
33413_thamno                       30913    0.017537   0.002662          29417
33588_przewalskii                  45282    0.018394   0.002772          42987
35236_rex                          53678    0.015655   0.001939          51485
35855_rex                          55421    0.019357   0.003986          52107
38362_rex                          51863    0.012369   0.002065          49989
39618_rex                          43044    0.014691   0.002916          41122
40578_rex                          55350    0.015747   0.002098          53177
41478_cyathophylloides             53965    0.012430   0.001714          51816
41954_cyathophylloides             73857    0.012264   0.004415          70662


Full stats files
------------------------------------------------
step 1: ./analysis-ipyrad/pedicularis_s1_demultiplex_stats.txt
step 2: ./analysis-ipyrad/pedicularis_edits/s2_rawedit_stats.txt
step 3: ./analysis-ipyrad/pedicularis_clust_0.85/s3_cluster_stats.txt
step 4: ./analysis-ipyrad/pedicularis_clust_0.85/s4_joint_estimate.txt
step 5: ./analysis-ipyrad/pedicularis_consens/s5_consens_stats.txt
step 6: ./analysis-ipyrad/pedicularis_consens/s6_cluster_stats.txt
step 7: ./analysis-ipyrad/pedicularis_outfiles/pedicularis_stats.txt

Take a look at the stats summary

Each assembly that finishes step 7 will create a stats.txt output summary in the ‘assembly_name’_outfiles/ directory. This includes information about which filters removed data from the assembly, how many loci were recovered per sample, how many samples had data for each locus, and how many variable sites are in the assembled data.

cat ./pedicularis/base_outfiles/base_stats.txt
## The number of loci caught by each filter.
## ipyrad API location: [assembly].statsfiles.s7_filters

                            total_filters  applied_order  retained_loci
total_prefiltered_loci              88341              0          88341
filtered_by_rm_duplicates            2566           2566          85775
filtered_by_max_indels                518            518          85257
filtered_by_max_snps                  212            121          85136
filtered_by_max_shared_het            946            908          84228
filtered_by_min_sample              39170          38942          45286
filtered_by_max_alleles             10196           5101          40185
total_filtered_loci                 40185              0          40185


## The number of loci recovered for each Sample.
## ipyrad API location: [assembly].stats_dfs.s7_samples

                        sample_coverage
29154_superba                     20755
30556_thamno                      30996
30686_cyathophylla                26288
32082_przewalskii                 14496
33413_thamno                      18214
33588_przewalskii                 16846
35236_rex                         32353
35855_rex                         32397
38362_rex                         32795
39618_rex                         27194
40578_rex                         33154
41478_cyathophylloides            30667
41954_cyathophylloides            27961


## The number of loci for which N taxa have data.
## ipyrad API location: [assembly].stats_dfs.s7_loci

    locus_coverage  sum_coverage
1                0             0
2                0             0
3                0             0
4             5136          5136
5             3702          8838
6             3311         12149
7             2942         15091
8             3028         18119
9             4014         22133
10            4904         27037
11            5486         32523
12            4740         37263
13            2922         40185


## The distribution of SNPs (var and pis) across loci.
## var = all variable sites (pis + autapomorphies)
## pis = parsimony informative site (minor allele in >1 sample)
## ipyrad API location: [assembly].stats_dfs.s7_snps

     var  sum_var    pis  sum_pis
0   2107        0  10483        0
1   3878     3878   9695     9695
2   5048    13974   7088    23871
3   5365    30069   4765    38166
4   4921    49753   3084    50502
5   4330    71403   1960    60302
6   3532    92595   1260    67862
7   2975   113420    819    73595
8   2253   131444    489    77507
9   1743   147131    270    79937
10  1331   160441    144    81377
11   948   170869     73    82180
12   665   178849     26    82492
13   388   183893     19    82739
14   271   187687      9    82865
15   178   190357      0    82865
16   111   192133      1    82881
17    65   193238      0    82881
18    39   193940      0    82881
19    27   194453      0    82881
20    10   194653      0    82881

Take a peek at the .loci output

This is the first places I look when an assembly finishes. It provides a clean view of the data with variable sites (-) and parsimony informative SNPs (*) highlighted. Use the unix commands less or head to look at this file briefly. Each locus is labelled with a number corresponding to the locus order before filters are applied in step 7. If you branch this assembly and run step 7 again with a different set of parameters you may recover fewer or more total loci.

## head -n 50 prints just the first 50 lines of the file to stdout
head -n 50 pedicularis/base_outfiles/base.loci
29154_superba              TCTGGTCCCGCGGGTGATCAAGGCCCCACCACCGCGTCTCACATTTTCGATCTCAGGCG
30556_thamno               TCCGGTCCCGCGGGTGATCAAGGCCCCACCACCGCGTCTCACATTCTAGATCTCAGGCG
30686_cyathophylla         TCCAGTCCCGCGGGTGATCAAGGCCCCACCACCGCATCTCACATTCTCGATCTCAGGCG
33413_thamno               TCCGGTCCTTCGGGTGATCAAGGCCCCACCACCGCGTCTCACATTCTAGATCTCAGGCG
35236_rex                  TCCGGTCCCGCGGGTGATCAAGGCCCCACCACCGCGTCTCACATTCTMGATCTCAGGCG
35855_rex                  TCCGGTCCCGCGGGTGATCAAGGCCCCACCACCGCGTCTCACATTCTAGATCTCAGGCG
38362_rex                  TCCGGTCCTTCGGGTGATCAAGGCCCCACCACCGCGTCTCACATTCTAGATCTCAGGCG
40578_rex                  TCCGGTCCYKCGGGTGATCAAGGCCCCACCACCGCGTCTCACATTCTCGATCTCAGGCG
41478_cyathophylloides     TCCGGTCCCGCGGGTGATCAAGGCCCCACCACCGCGTCTCACATTATCGATCTCAGGCG
41954_cyathophylloides     TCCGGTCCCGCGGGTGATCAAGGCCCCACCACCGCGTCTCACATTATCGATCTCAGGCG
//                           --    **                         -         * *           |1|
29154_superba              TAAAAGCGAGTCACATCTAATGATCTAAAATCTGTAGTATTGTGAAATATATGCTTAAA
30556_thamno               TAAAAGCGAGTCACATCTAATGATCTAAAATCTGTGGTATTGTGAAATATATGCTTAAA
30686_cyathophylla         TAAAAGCGAGTCACATCTAATGATCTANAATCTGTGGTATTGTGAAATATATGCTTAAA
33413_thamno               TAAAAGCAAGTCACATCTAATGATCTAAAATCTGTGGTATTGTGAAATATATGCTTAAA
35236_rex                  TAAAAGCGAGTCACATCTAATGATCTAAAATCTGTGGTATTGTGAAATATATGCTTAAA
35855_rex                  TAAAAGCGAGTCACATCTAATGATCTAAAATCTGTGGTATTGTGAAATATATGCTTAAA
38362_rex                  TAAAAGCGAGTCACATCTAATGATCTAAAATCTGTGGTATTGTGAAATATATGCTCAAA
39618_rex                  TAAAAGCGAGTCACATCTAATGATCTAAAATCTGTGGTATTGTGAAATATATGCTCAAA
40578_rex                  TAAAAGCGAGTCACATCTAATGATCTAAAMTCTGTGGTATTGTGAAATATATGCTTAAA
41478_cyathophylloides     TAAAAGCGAGTCACATCTAATGATCTAAAATCTGTGGTATTGTGAAATATATGCTTAAA
41954_cyathophylloides     TAAAAGCGAGTCACATCTAATGATCTAAAATCTGTGGTATTGTGAAATATATGCTTAAA
//                                -                     -     -                   *   |3|
29154_superba              AATGGGTTGTTCCATGGATAACAACTCCGTTTTATRCCAAATACTGTGACACGCACRCA
32082_przewalskii          AATGGGTTGTTCCATGGTTAACAACTCCGTTTTATGCCAACTACTGCGACACACACGCA
33588_przewalskii          AATGGGTTGTTCCATGGTTAACAACTCCGTTTTATGCCAACTACTGCGACACGCACGCA
41478_cyathophylloides     AATGGGTTGTTCCATGGATAACAACTCCGTTTTATGCCAAATACTGTGACACGCACGCA
41954_cyathophylloides     AATGGGTTGTTCCATGGATAACAACTCCGTTTTATGCCAAATACTGTGACACGCACGCA
//                                          *                 -    *     *     -   -  |5|
29154_superba              AGCCGATTCGGTCGCGAGCAGCGATATTTTGTTTCCCCTCAAAATCTTCACAATCTCTA
30686_cyathophylla         AGCCGATTTGGTTGCGAGCAGCGATATTTTGTTTCCCCTCAAAATCTTCACAATCTCCG
35236_rex                  AGCYGATTTGGTCGCGAGCAGCGATGTTTTGTTTCCCCTCAAAATCTTCATAATCTCTA
38362_rex                  AGCYGATTTGGTYGCGAGCAGCGATRTTTTGYTTCCCCTCAAAATCTTCAYAATCTCYR
41478_cyathophylloides     AGCCGATTTGGTTGCGAGCAGCGATATTTTGTTTCCCCTCAAAATCTTCACAATCTCCA
41954_cyathophylloides     AGCCGATTTGGTTGCGAGCAGCGATATTTTGTTTCCCCTCAAAATCTTCACAATCTCCA
//                            *    -   *            *     -                  *      **|7|
29154_superba              TCGACGCCATGTATGACTGTTCAAAATATCAAATGTACT-ATTACNACCACCCTTTTTT
30686_cyathophylla         TCGACGCCATGTATGACTGTTCAAAATATCAAATGTACTAATTACCACCACCCTTTTTT
38362_rex                  TCGACGCCATGTATGACTGTTCAAAATATCAAATGTACT-ATTACCACCACCCTTTTTT
40578_rex                  TCGACGCCATNTATGACTGTTCAAAATATCAAACGTACT-ATTACCACCACCCTTTTTT
//                                                          -                         |14|
29154_superba              ATCGATCATTTCGCCTCACAGTTGCTGGGTGCAGAAAAANNTCTTCATCTGATTCAGGT
30556_thamno               ATCGATCATTTCTTCTCACAGTTGCTGGGTGCAGAAAAAATTCTTCATCTGATTCAGGT
30686_cyathophylla         ATCGATCATTTCGCCTCACAGTTGCTGGGTGCAGAAAAAATTCTTCATCTGATTCAGGT
32082_przewalskii          ATCGATCATTTCGCCTCACAGTTGCTGGATGCAGAAAAAATTCTTCATCTGATTCAGGT
33413_thamno               ATCGATCATTTCTNCTCACAGTTGCTGGGTNCAGAAAA---------------------
33588_przewalskii          ATCGATCATTTCGCCTCACAGTTGCTGGATGCAGAAAAAATTCTTCATCTGATTCAGGT
35236_rex                  ATCGATCATTTCTCCTCACAGTTGCTGGGTGCAGAAAAAATTCTTCATCTGATTCAGGT
35855_rex                  ATCGATCATTTCTCCTCACAGTTGCTGGGTGCAGAAAAAATTCTTCATCTGATTCAGGT
38362_rex                  ATCGATCATTTCTCCTCACAGTTGCTGGGTGCAAAAAAAATTCTTCATCTGATTCAGGT
39618_rex                  ATCGATCATTTCTCCTCACAGTTGCTGGGTGCAAAAAAAATTCTTCATCTGATTCAGGT
40578_rex                  ATCGATCATTTCTCCTCACAGTTGCTGGGTGCAGAAAAAATTCTTCATCTGATTCAGGT
41478_cyathophylloides     ATCGATCATTTCGCCTCACAGTTGCTGGGTGCAGAAAAAATTCTTCATCTGATTCAGGT
41954_cyathophylloides     ATCGATCATTTCGCCTCACAGTTGCTGGGTGCAGAAAAAATTCTTCATCTGATTCAGGT
//                                     *-              *    *                         |16|

peek at the .phy files

This is the concatenated sequence file of all loci in the data set. It is typically used in phylogenetic analyses, like in the program raxml. This super matrix is 13 taxon deep by 2.44 Mbp long.

## cut -c 1-80 prints only the first 80 characters of the file
cut -c 1-80 pedicularis/base_outfiles/base.phy
13 2577585
29154_superba              AATGATGGTGGTACACATATTAATTACAATTTGGACAACGGCGGCTTTGTTCA
30556_thamno               ACAGATGGTGGTACACATGTCAATTACAATTTGGATAACGGCGGNNNNNNNNN
30686_cyathophylla         AATGATGGTGGTACACATATTAATTACAATTTGGACAACGGCGGCTTTGTTCA
32082_przewalskii          NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
33413_thamno               AGTGATGGTGGTACACATGTCNANTACAATTTGGACAACGGCGGCTTTGTTCN
33588_przewalskii          NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
35236_rex                  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
35855_rex                  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
38362_rex                  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
39618_rex                  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
40578_rex                  AATGATGGTGGTACACATATYAATTACAAYTTGGAYAACGGCGGCTTTGTTCA
41478_cyathophylloides     NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
41954_cyathophylloides     NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

peek at the .snps.phy file

This is similar to the phylip file format, but only variable site columns are included. All SNPs are in the file, in contrast to the .u.snps.phy file, which randomly selects only a single SNP per locus.

## cut -c 1-80 prints only the first 80 characters of the file
cut -c 1-80 pedicularis/base_outfiles/base.snps.phy
13 194653
29154_superba              ATATTCAAACTATTCAAAGTAACTGATGAAAYCTAGGGGAKCAGTTCGCGTGC
30556_thamno               CAGCTTAAATTATNNGGCGCAACCGGAGAAANNNNNNNNNGAAGGTTACATNN
30686_cyathophylla         ATATTCAAACTATAANNNNNAACTGATGAAACTTGTCGGNGCAGGTTACATGC
32082_przewalskii          NNNNNNNNNNNNNACNNNNNCANNNNNNNNNNNNNNNNNCNNNNGTCGCGTNN
33413_thamno               GTGCTCAAATTAANNNNNNNAGCCGAAGAAACCCGGCATNGCAKGTTANANNN
33588_przewalskii          NNNNNNNNNNNNNACNNNNNAANNNNNNNNNNNNNNNNNCNNNNGTCGCGYNN
35236_rex                  NNNNNNAAATTGTNNGGCGTAACCAAAGAAANNNNNNNNNGCAGGTTAAATNN
35855_rex                  NNNNNNACATTATNNNNNNNAATCGAAGAAANNNNNNNNNNNNNGTTACATGC
38362_rex                  NNNNNNGAATTATNNNNNNNAACCAAAGAAACCCG-CCGNNNNNGTTACATNN
39618_rex                  NNNNNNGAATTATNNNNNNNAACCAAAGAAACCCG-CCGNNNNNGKTACATNN
40578_rex                  ATAYYYRAATYATNNGGCKTAACCGAAGAGGNNNNNNNNNNNNNGTTACATRC
41478_cyathophylloides     NNNNNNATTTTATACNNNNNAACTGATTGAACCTAGGGGAGCGGGTTACATGT
41954_cyathophylloides     NNNNNNATTTTATACNNNNNAANNNNNNNNNCCTAGGGGAGCGGGTTACATGT

peek at the .vcf.gz file

The VCF output for ipyrad contains the full sequence information for all samples as well as the sequencing depth information for all base calls that were made. This file should be easily parsable if users want to extract information or modify it so that this file can be used in other software such as GATK. We are working on developing our own population-aware genotype caller that will correct low-depth base calls at this stage. Stay tuned.

## gunzip -c decompresses the file and passes it to the pipe (|)
## head -n 50 reads data from the pipe and show the first 50 lines.
## and we pipe this to 'cut', which shows only the first 80 rows of data
## for easier viewing.

head -n 50 pedicularis/base_outfiles/base.vcf | cut -c 1-80
##fileformat=VCFv4.0
##fileDate=2017/02/14
##source=ipyrad_v.0.5.15
##reference=pseudo-reference (most common base at site)
##phasing=unphased
##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of Samples With Dat
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
##FORMAT=<ID=CATG,Number=1,Type=String,Description="Base Counts (CATG)">
#CHROM  POS ID  REF ALT QUAL  FILTER  INFO  FORMAT  29154_superba 30556_thamno  30
locus_1 2 . A C,G 13  PASS  NS=5;DP=49  GT:DP:CATG  0/0:9:0,9,0,0 1/1:7:7,0,0,0
locus_1 3 . T A 13  PASS  NS=5;DP=49  GT:DP:CATG  0/0:9:0,0,9,0 1/1:7:0,7,0,0 0
locus_1 19  . A G 13  PASS  NS=5;DP=49  GT:DP:CATG  0/0:9:0,9,0,0 1/1:7:0,0,0,7
locus_1 21  . C T 13  PASS  NS=5;DP=49  GT:DP:CATG  1/1:9:0,0,9,0 0/0:7:7,0,0,0
locus_1 30  . T C 13  PASS  NS=5;DP=49  GT:DP:CATG  0/0:9:0,0,9,0 0/0:7:0,0,7,0
locus_1 36  . C T 13  PASS  NS=5;DP=49  GT:DP:CATG  0/0:9:9,0,0,0 1/1:7:0,0,7,0
locus_2 15  . A G 13  PASS  NS=11;DP=210  GT:DP:CATG  0/0:12:0,12,0,0 0/0:24:0,2
locus_2 16  . A T,C 13  PASS  NS=11;DP=210  GT:DP:CATG  0/0:12:0,12,0,0 0/0:24:0
locus_2 18  . A T 13  PASS  NS=11;DP=210  GT:DP:CATG  0/0:12:0,12,0,0 0/0:24:0,2
locus_2 20  . T C 13  PASS  NS=11;DP=210  GT:DP:CATG  1/1:12:12,0,0,0 0/0:24:0,0
locus_2 29  . T C 13  PASS  NS=11;DP=209  GT:DP:CATG  0/0:12:0,0,12,0 0/0:23:0,0
locus_2 30  . A G 13  PASS  NS=11;DP=209  GT:DP:CATG  0/0:12:0,12,0,0 0/0:23:0,2
locus_2 47  . T A 13  PASS  NS=11;DP=210  GT:DP:CATG  0/0:12:0,0,12,0 0/0:24:0,0
locus_3 46  . A T 13  PASS  NS=6;DP=69  GT:DP:CATG  1/1:10:0,0,10,0 ./.:0:0,0,0,
locus_3 62  . C A 13  PASS  NS=6;DP=68  GT:DP:CATG  0/0:10:10,0,0,0 ./.:0:0,0,0,
locus_6 11  . G A 13  PASS  NS=4;DP=67  GT:DP:CATG  1/1:11:0,11,0,0 0/0:7:0,0,0,
locus_6 29  . G A 13  PASS  NS=4;DP=67  GT:DP:CATG  1/1:11:0,11,0,0 0/0:7:0,0,0,
locus_6 34  . C A 13  PASS  NS=4;DP=67  GT:DP:CATG  1/1:11:0,11,0,0 0/0:7:7,0,0,
locus_6 35  . G T 13  PASS  NS=4;DP=67  GT:DP:CATG  0/0:11:0,0,0,11 0/0:7:0,0,0,
locus_6 40  . T C 13  PASS  NS=4;DP=67  GT:DP:CATG  0/0:11:0,0,11,0 1/1:7:7,0,0,
locus_9 19  . A C 13  PASS  NS=13;DP=224  GT:DP:CATG  0/0:12:0,12,0,0 0/0:22:0,2
locus_9 25  . A G 13  PASS  NS=13;DP=224  GT:DP:CATG  0/0:12:0,12,0,0 0/0:22:0,2
locus_11  4 . C T 13  PASS  NS=10;DP=137  GT:DP:CATG  0/0:11:11,0,0,0 0/0:17:17,
locus_11  13  . C T 13  PASS  NS=10;DP=137  GT:DP:CATG  1/1:11:0,1,10,0 0/0:17:17
locus_11  21  . G A 13  PASS  NS=10;DP=137  GT:DP:CATG  0/0:11:0,0,0,11 0/0:17:0,
locus_11  23  . A G 13  PASS  NS=10;DP=137  GT:DP:CATG  0/0:11:0,11,0,0 1/1:17:0,
locus_11  24  . A T 13  PASS  NS=10;DP=137  GT:DP:CATG  1/1:11:0,0,11,0 0/0:17:0,
locus_11  38  . G T 13  PASS  NS=10;DP=137  GT:DP:CATG  0/0:11:0,0,0,11 0/0:17:0,
locus_11  42  . A G 13  PASS  NS=10;DP=137  GT:DP:CATG  0/0:11:0,11,0,0 0/0:17:0,
locus_11  54  . A G 13  PASS  NS=10;DP=137  GT:DP:CATG  0/0:11:0,11,0,0 0/0:17:0,
locus_11  55  . A G 13  PASS  NS=10;DP=137  GT:DP:CATG  0/0:11:0,11,0,0 0/0:17:0,
locus_12  6 . C T 13  PASS  NS=7;DP=94  GT:DP:CATG  1/0:7:4,0,3,0 ./.:0:0,0,0,0
locus_12  20  . C T 13  PASS  NS=7;DP=94  GT:DP:CATG  0/0:7:7,0,0,0 ./.:0:0,0,0,0
locus_12  31  . T C 13  PASS  NS=7;DP=94  GT:DP:CATG  0/0:7:0,0,7,0 ./.:0:0,0,0,0
locus_12  33  . G A 13  PASS  NS=7;DP=94  GT:DP:CATG  1/1:7:0,7,0,0 ./.:0:0,0,0,0
locus_12  37  . G T 13  PASS  NS=5;DP=52  GT:DP:CATG  0/0:7:0,0,0,7 ./.:0:0,0,0,0
locus_12  43  . C G 13  PASS  NS=7;DP=94  GT:DP:CATG  1/1:7:0,0,0,7 ./.:0:0,0,0,0
locus_12  45  . G C,A 13  PASS  NS=7;DP=94  GT:DP:CATG  0/0:7:0,0,0,7 ./.:0:0,0,0
locus_12  47  . G T 13  PASS  NS=7;DP=94  GT:DP:CATG  0/0:7:0,0,0,7 ./.:0:0,0,0,0